Review



phtpp tocris  (Tocris)


Bioz Verified Symbol Tocris is a verified supplier
Bioz Manufacturer Symbol Tocris manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Tocris phtpp tocris
    Figure 5. Action of <t>17</t> <t>Beta-Estradiol</t> Occurs Locally in the Cortex through Estrogen Receptor b in PV+ Neurons (A) In vivo local application of 17 beta-estradiol to the surface of the cortex with juxtacellular recording in ovariectomized female rats. (B) Example traces of fast-spiking neuron after vehicle application (above) and 17 beta-estradiol application (below) after 2 h of diffusion. (C) Ongoing firing rates of all recorded cells after vehicle or 17 beta-estradiol application to cortex (Mann-Whitney U test, p = 0.013; N = 9 Veh, N = 14 E2; experiment and analysis performed blind to condition). (D) VGAT-Venus transgenic rats were ovariectomized 2 weeks prior to brain slice recording. Coronal brain slices were prepared 2–3.5 mm posterior from Bregma. Layer V cells were selected with fluorescent illumination and characteristic fast-spiking neuron firing patterns (example trace). (E) Example of recorded cell which underwent post hoc processing to confirm that it was PV+. VGAT-Venus signal (left), PV/Alexa 633 nm signal (middle), Streptdavidin 350 nm signal (right) are shown. (F) Example of cell after baseline characterization (left) and after 250 nM 17 beta-estradiol wash-in (right). (G) Change in rheobase after estradiol wash-in for all recorded fast-spiking cells (Wilcoxon signed rank test, p = 0.002; N = 10). (H) Change in rheobase after estradiol in the presence of estrogen receptor b blocker <t>PHTPP</t> (passed Shapiro-Wilk normality test; paired t test, p = 0.521; N = 5). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Horizontal bars represent means. See also Table S1.
    Phtpp Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 205 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phtpp tocris/product/Tocris
    Average 95 stars, based on 205 article reviews
    phtpp tocris - by Bioz Stars, 2026-03
    95/100 stars

    Images

    1) Product Images from "Estrus-Cycle Regulation of Cortical Inhibition."

    Article Title: Estrus-Cycle Regulation of Cortical Inhibition.

    Journal: Current biology : CB

    doi: 10.1016/j.cub.2019.01.045

    Figure 5. Action of 17 Beta-Estradiol Occurs Locally in the Cortex through Estrogen Receptor b in PV+ Neurons (A) In vivo local application of 17 beta-estradiol to the surface of the cortex with juxtacellular recording in ovariectomized female rats. (B) Example traces of fast-spiking neuron after vehicle application (above) and 17 beta-estradiol application (below) after 2 h of diffusion. (C) Ongoing firing rates of all recorded cells after vehicle or 17 beta-estradiol application to cortex (Mann-Whitney U test, p = 0.013; N = 9 Veh, N = 14 E2; experiment and analysis performed blind to condition). (D) VGAT-Venus transgenic rats were ovariectomized 2 weeks prior to brain slice recording. Coronal brain slices were prepared 2–3.5 mm posterior from Bregma. Layer V cells were selected with fluorescent illumination and characteristic fast-spiking neuron firing patterns (example trace). (E) Example of recorded cell which underwent post hoc processing to confirm that it was PV+. VGAT-Venus signal (left), PV/Alexa 633 nm signal (middle), Streptdavidin 350 nm signal (right) are shown. (F) Example of cell after baseline characterization (left) and after 250 nM 17 beta-estradiol wash-in (right). (G) Change in rheobase after estradiol wash-in for all recorded fast-spiking cells (Wilcoxon signed rank test, p = 0.002; N = 10). (H) Change in rheobase after estradiol in the presence of estrogen receptor b blocker PHTPP (passed Shapiro-Wilk normality test; paired t test, p = 0.521; N = 5). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Horizontal bars represent means. See also Table S1.
    Figure Legend Snippet: Figure 5. Action of 17 Beta-Estradiol Occurs Locally in the Cortex through Estrogen Receptor b in PV+ Neurons (A) In vivo local application of 17 beta-estradiol to the surface of the cortex with juxtacellular recording in ovariectomized female rats. (B) Example traces of fast-spiking neuron after vehicle application (above) and 17 beta-estradiol application (below) after 2 h of diffusion. (C) Ongoing firing rates of all recorded cells after vehicle or 17 beta-estradiol application to cortex (Mann-Whitney U test, p = 0.013; N = 9 Veh, N = 14 E2; experiment and analysis performed blind to condition). (D) VGAT-Venus transgenic rats were ovariectomized 2 weeks prior to brain slice recording. Coronal brain slices were prepared 2–3.5 mm posterior from Bregma. Layer V cells were selected with fluorescent illumination and characteristic fast-spiking neuron firing patterns (example trace). (E) Example of recorded cell which underwent post hoc processing to confirm that it was PV+. VGAT-Venus signal (left), PV/Alexa 633 nm signal (middle), Streptdavidin 350 nm signal (right) are shown. (F) Example of cell after baseline characterization (left) and after 250 nM 17 beta-estradiol wash-in (right). (G) Change in rheobase after estradiol wash-in for all recorded fast-spiking cells (Wilcoxon signed rank test, p = 0.002; N = 10). (H) Change in rheobase after estradiol in the presence of estrogen receptor b blocker PHTPP (passed Shapiro-Wilk normality test; paired t test, p = 0.521; N = 5). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Horizontal bars represent means. See also Table S1.

    Techniques Used: In Vivo, Diffusion-based Assay, MANN-WHITNEY, Transgenic Assay, Slice Preparation



    Similar Products

    phtpp tocris  (Tocris)
    95
    Tocris phtpp tocris
    Figure 5. Action of <t>17</t> <t>Beta-Estradiol</t> Occurs Locally in the Cortex through Estrogen Receptor b in PV+ Neurons (A) In vivo local application of 17 beta-estradiol to the surface of the cortex with juxtacellular recording in ovariectomized female rats. (B) Example traces of fast-spiking neuron after vehicle application (above) and 17 beta-estradiol application (below) after 2 h of diffusion. (C) Ongoing firing rates of all recorded cells after vehicle or 17 beta-estradiol application to cortex (Mann-Whitney U test, p = 0.013; N = 9 Veh, N = 14 E2; experiment and analysis performed blind to condition). (D) VGAT-Venus transgenic rats were ovariectomized 2 weeks prior to brain slice recording. Coronal brain slices were prepared 2–3.5 mm posterior from Bregma. Layer V cells were selected with fluorescent illumination and characteristic fast-spiking neuron firing patterns (example trace). (E) Example of recorded cell which underwent post hoc processing to confirm that it was PV+. VGAT-Venus signal (left), PV/Alexa 633 nm signal (middle), Streptdavidin 350 nm signal (right) are shown. (F) Example of cell after baseline characterization (left) and after 250 nM 17 beta-estradiol wash-in (right). (G) Change in rheobase after estradiol wash-in for all recorded fast-spiking cells (Wilcoxon signed rank test, p = 0.002; N = 10). (H) Change in rheobase after estradiol in the presence of estrogen receptor b blocker <t>PHTPP</t> (passed Shapiro-Wilk normality test; paired t test, p = 0.521; N = 5). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Horizontal bars represent means. See also Table S1.
    Phtpp Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phtpp tocris/product/Tocris
    Average 95 stars, based on 1 article reviews
    phtpp tocris - by Bioz Stars, 2026-03
    95/100 stars
    		  Buy from Supplier
    saline phtpp er β antagonist tocris bioscience  (Tocris)
    94
    Tocris saline phtpp er β antagonist tocris bioscience
    Figure 5. Action of <t>17</t> <t>Beta-Estradiol</t> Occurs Locally in the Cortex through Estrogen Receptor b in PV+ Neurons (A) In vivo local application of 17 beta-estradiol to the surface of the cortex with juxtacellular recording in ovariectomized female rats. (B) Example traces of fast-spiking neuron after vehicle application (above) and 17 beta-estradiol application (below) after 2 h of diffusion. (C) Ongoing firing rates of all recorded cells after vehicle or 17 beta-estradiol application to cortex (Mann-Whitney U test, p = 0.013; N = 9 Veh, N = 14 E2; experiment and analysis performed blind to condition). (D) VGAT-Venus transgenic rats were ovariectomized 2 weeks prior to brain slice recording. Coronal brain slices were prepared 2–3.5 mm posterior from Bregma. Layer V cells were selected with fluorescent illumination and characteristic fast-spiking neuron firing patterns (example trace). (E) Example of recorded cell which underwent post hoc processing to confirm that it was PV+. VGAT-Venus signal (left), PV/Alexa 633 nm signal (middle), Streptdavidin 350 nm signal (right) are shown. (F) Example of cell after baseline characterization (left) and after 250 nM 17 beta-estradiol wash-in (right). (G) Change in rheobase after estradiol wash-in for all recorded fast-spiking cells (Wilcoxon signed rank test, p = 0.002; N = 10). (H) Change in rheobase after estradiol in the presence of estrogen receptor b blocker <t>PHTPP</t> (passed Shapiro-Wilk normality test; paired t test, p = 0.521; N = 5). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Horizontal bars represent means. See also Table S1.
    Saline Phtpp Er β Antagonist Tocris Bioscience, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/saline phtpp er β antagonist tocris bioscience/product/Tocris
    Average 94 stars, based on 1 article reviews
    saline phtpp er β antagonist tocris bioscience - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    130 phtpp tocris bioscience  (Tocris)
    94
    Tocris 130 phtpp tocris bioscience
    Figure 5. Action of <t>17</t> <t>Beta-Estradiol</t> Occurs Locally in the Cortex through Estrogen Receptor b in PV+ Neurons (A) In vivo local application of 17 beta-estradiol to the surface of the cortex with juxtacellular recording in ovariectomized female rats. (B) Example traces of fast-spiking neuron after vehicle application (above) and 17 beta-estradiol application (below) after 2 h of diffusion. (C) Ongoing firing rates of all recorded cells after vehicle or 17 beta-estradiol application to cortex (Mann-Whitney U test, p = 0.013; N = 9 Veh, N = 14 E2; experiment and analysis performed blind to condition). (D) VGAT-Venus transgenic rats were ovariectomized 2 weeks prior to brain slice recording. Coronal brain slices were prepared 2–3.5 mm posterior from Bregma. Layer V cells were selected with fluorescent illumination and characteristic fast-spiking neuron firing patterns (example trace). (E) Example of recorded cell which underwent post hoc processing to confirm that it was PV+. VGAT-Venus signal (left), PV/Alexa 633 nm signal (middle), Streptdavidin 350 nm signal (right) are shown. (F) Example of cell after baseline characterization (left) and after 250 nM 17 beta-estradiol wash-in (right). (G) Change in rheobase after estradiol wash-in for all recorded fast-spiking cells (Wilcoxon signed rank test, p = 0.002; N = 10). (H) Change in rheobase after estradiol in the presence of estrogen receptor b blocker <t>PHTPP</t> (passed Shapiro-Wilk normality test; paired t test, p = 0.521; N = 5). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Horizontal bars represent means. See also Table S1.
    130 Phtpp Tocris Bioscience, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/130 phtpp tocris bioscience/product/Tocris
    Average 94 stars, based on 1 article reviews
    130 phtpp tocris bioscience - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    phtpp tocris bioscience  (Tocris)
    94
    Tocris phtpp tocris bioscience
    Figure 5. Action of <t>17</t> <t>Beta-Estradiol</t> Occurs Locally in the Cortex through Estrogen Receptor b in PV+ Neurons (A) In vivo local application of 17 beta-estradiol to the surface of the cortex with juxtacellular recording in ovariectomized female rats. (B) Example traces of fast-spiking neuron after vehicle application (above) and 17 beta-estradiol application (below) after 2 h of diffusion. (C) Ongoing firing rates of all recorded cells after vehicle or 17 beta-estradiol application to cortex (Mann-Whitney U test, p = 0.013; N = 9 Veh, N = 14 E2; experiment and analysis performed blind to condition). (D) VGAT-Venus transgenic rats were ovariectomized 2 weeks prior to brain slice recording. Coronal brain slices were prepared 2–3.5 mm posterior from Bregma. Layer V cells were selected with fluorescent illumination and characteristic fast-spiking neuron firing patterns (example trace). (E) Example of recorded cell which underwent post hoc processing to confirm that it was PV+. VGAT-Venus signal (left), PV/Alexa 633 nm signal (middle), Streptdavidin 350 nm signal (right) are shown. (F) Example of cell after baseline characterization (left) and after 250 nM 17 beta-estradiol wash-in (right). (G) Change in rheobase after estradiol wash-in for all recorded fast-spiking cells (Wilcoxon signed rank test, p = 0.002; N = 10). (H) Change in rheobase after estradiol in the presence of estrogen receptor b blocker <t>PHTPP</t> (passed Shapiro-Wilk normality test; paired t test, p = 0.521; N = 5). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Horizontal bars represent means. See also Table S1.
    Phtpp Tocris Bioscience, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phtpp tocris bioscience/product/Tocris
    Average 94 stars, based on 1 article reviews
    phtpp tocris bioscience - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 5. Action of 17 Beta-Estradiol Occurs Locally in the Cortex through Estrogen Receptor b in PV+ Neurons (A) In vivo local application of 17 beta-estradiol to the surface of the cortex with juxtacellular recording in ovariectomized female rats. (B) Example traces of fast-spiking neuron after vehicle application (above) and 17 beta-estradiol application (below) after 2 h of diffusion. (C) Ongoing firing rates of all recorded cells after vehicle or 17 beta-estradiol application to cortex (Mann-Whitney U test, p = 0.013; N = 9 Veh, N = 14 E2; experiment and analysis performed blind to condition). (D) VGAT-Venus transgenic rats were ovariectomized 2 weeks prior to brain slice recording. Coronal brain slices were prepared 2–3.5 mm posterior from Bregma. Layer V cells were selected with fluorescent illumination and characteristic fast-spiking neuron firing patterns (example trace). (E) Example of recorded cell which underwent post hoc processing to confirm that it was PV+. VGAT-Venus signal (left), PV/Alexa 633 nm signal (middle), Streptdavidin 350 nm signal (right) are shown. (F) Example of cell after baseline characterization (left) and after 250 nM 17 beta-estradiol wash-in (right). (G) Change in rheobase after estradiol wash-in for all recorded fast-spiking cells (Wilcoxon signed rank test, p = 0.002; N = 10). (H) Change in rheobase after estradiol in the presence of estrogen receptor b blocker PHTPP (passed Shapiro-Wilk normality test; paired t test, p = 0.521; N = 5). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Horizontal bars represent means. See also Table S1.

    Journal: Current biology : CB

    Article Title: Estrus-Cycle Regulation of Cortical Inhibition.

    doi: 10.1016/j.cub.2019.01.045

    Figure Lengend Snippet: Figure 5. Action of 17 Beta-Estradiol Occurs Locally in the Cortex through Estrogen Receptor b in PV+ Neurons (A) In vivo local application of 17 beta-estradiol to the surface of the cortex with juxtacellular recording in ovariectomized female rats. (B) Example traces of fast-spiking neuron after vehicle application (above) and 17 beta-estradiol application (below) after 2 h of diffusion. (C) Ongoing firing rates of all recorded cells after vehicle or 17 beta-estradiol application to cortex (Mann-Whitney U test, p = 0.013; N = 9 Veh, N = 14 E2; experiment and analysis performed blind to condition). (D) VGAT-Venus transgenic rats were ovariectomized 2 weeks prior to brain slice recording. Coronal brain slices were prepared 2–3.5 mm posterior from Bregma. Layer V cells were selected with fluorescent illumination and characteristic fast-spiking neuron firing patterns (example trace). (E) Example of recorded cell which underwent post hoc processing to confirm that it was PV+. VGAT-Venus signal (left), PV/Alexa 633 nm signal (middle), Streptdavidin 350 nm signal (right) are shown. (F) Example of cell after baseline characterization (left) and after 250 nM 17 beta-estradiol wash-in (right). (G) Change in rheobase after estradiol wash-in for all recorded fast-spiking cells (Wilcoxon signed rank test, p = 0.002; N = 10). (H) Change in rheobase after estradiol in the presence of estrogen receptor b blocker PHTPP (passed Shapiro-Wilk normality test; paired t test, p = 0.521; N = 5). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Horizontal bars represent means. See also Table S1.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti-Parvalbumin Swant Cat#PVG-213; RRID:AB_2650496 Mouse anti-parvalbumin Swant Cat#V235; RRID:AB_10000343 Donkey anti-Goat, Alexa Fluor 546 ThermoFisher Cat#A-11056; RRID:AB_142628 Donkey anti-Goat, Alexa Fluor 633 ThermoFisher Cat#A-21082; RRID:AB_141493 Anti-Digoxigenin-AP Fab fragments Roche cat# 11093274910; RRID: AB_514497 Anti-Digoxigenin-POD Fab fragments Roche cat# 11207733910; RRID: AB_514500 Alexa Fluor 594 Donkey Anti-Mouse Jackson ImmunoResearch Laboratories 715-585-150; RRID:AB_2340854 Chemicals, Peptides, and Recombinant Proteins 17 beta-estradiol Sigma Cat#E8875 PHTPP Tocris Cat#2662 Neurobiotin Vector Cat#SP-1120; RRID:AB_2313575 Alexa Fluor 488 Streptavidin Invitrogen Cat#S11223; RRID:AB_2336881 Alexa Fluor 546 Streptavidin Invitrogen Cat#S11225; RRID:AB_2532130 Alexa Fluor 350 Streptavidin Invitrogen Cat#S11249 Roti-Mount FluoCare DAPI Carl Roth Cat#HP20.1 DMSO Sigma Cat#D2650 Sesame Oil Sigma Aldrich Cat#S3547 QX-314 Tocris Cat#2313 Blocking reagent Roche Cat# 11096176001 NBT Roche Cat# 11383213001 BCIP Roche Cat# 11383221001 DIG-labeling nucleotide mix Roche Cat# 11277073910 Cy2 Streptavidin Jackson ImmunoResearch Laboratories Cat# 016-220-084; RRID:AB_2337246 Biotin-tyramide ApexBIO Cat# A8011 Fluoroshield with DAPI Sigma Cat# F6057 pEASY-Blunt Zero Cloning Kit Transgen Biotech Cat# CB501 2 3 Phusion master mix NEB Cat# M0531 Critical Commercial Assays Vectastain ABC Kit Vector Laboratories Cat#PK-4000 Experimental Models: Organisms/Strains Rat: Wistar Janvier Labs N/A Rat: Wistar Harlan Laboratories N/A Rat: Sprague Dawley Beijing Vital River Laboratory Animal Technology Co., Ltd. N/A Rat: VGAT-Venus transgenic [28, 29] N/A Oligonucleotides primer rEsr2-v1 forward: AGTAGGAATGGTCAAGTGTGGATCCAGG This paper N/A primer rEsr2-v1 reverse: GAGAAAGAAGCATCAGGAGGTTGGCC This paper N/A primer rEsr2-v2 forward: ATGAAGTGTGGTCCCTGGACGC This paper N/A primer rEsr2-v2 reverse: AGGAGACAGGTGCCCAGAAGTTGG This paper N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Spike2 CED N/A (Continued on next page) e1 Current Biology 29, 1–11.e1–e6, February 18, 2019

    Techniques: In Vivo, Diffusion-based Assay, MANN-WHITNEY, Transgenic Assay, Slice Preparation